# Building Modified DNA topology

**URL:** <https://gromacs.bioexcel.eu/t/building-modified-dna-topology/3486>\
**Category:** User discussions\
**Created:** [January 16, 2022, 10:49am UTC](https://gromacs.bioexcel.eu/t/building-modified-dna-topology/3486 "2022-01-16T10:49:34Z")\
**Posts on this page:** 5\
**Page:** 1

<div class="post-metadata">

**Author:** ![reza786](https://avatars.discourse-cdn.com/v4/letter/r/e8c25b/32.png) [@reza786](https://gromacs.bioexcel.eu/u/reza786)\
**Post date:** [January 16, 2022, 10:49am UTC](https://gromacs.bioexcel.eu/t/building-modified-dna-topology/3486/1 "2022-01-16T10:49:34Z")

</div>

GROMACS version: 2021.4  
GROMACS modification: Yes/No  
Here post your question

I am having trouble generating topology for a type of modified DNA, but I’m not sure how to do it.  
In fact, there is a 35-nucleotide sequence of ssDNA. Using the Discovery Studio program, I converted the Thymidine Oxygen 4 atom to Sulfur in my sequence. Unfortunately, I have not been able to discover any server or method for constructing its topology.  
Could you please help me to overcome this issue?

Here, this is my sequence and the bold T one is the nucleotide which I need to alter the Oxygen 4 atom to Sulfur.

TGTCCGCGTACCG **T** ACGAGTTGCGAATGCAACGTA

 ![Capture2](https://europe1.discourse-cdn.com/flex017/uploads/bioexcel1/original/2X/4/4db83ee103d7e7c650e7fb915beb1296caa86149.jpeg)

---

<div class="post-metadata">

**Author:** ![jalemkul](https://dub1.discourse-cdn.com/flex017/user_avatar/gromacs.bioexcel.eu/jalemkul/32/18_2.png) [@jalemkul](https://gromacs.bioexcel.eu/u/jalemkul)\
**Post date:** [January 16, 2022, 1:54pm UTC](https://gromacs.bioexcel.eu/t/building-modified-dna-topology/3486/2 "2022-01-16T13:54:46Z")

</div>

CHARMM36 supports this species - it is residue 4SU, though it is built as an RNA nucleotide, it is trivial to modify the 2’ group to be the deoxy form.

---

<div class="post-metadata">

**Author:** ![reza786](https://avatars.discourse-cdn.com/v4/letter/r/e8c25b/32.png) [@reza786](https://gromacs.bioexcel.eu/u/reza786)\
**Post date:** [January 19, 2022, 10:05am UTC](https://gromacs.bioexcel.eu/t/building-modified-dna-topology/3486/3 "2022-01-19T10:05:17Z")

</div>

Thanks, dear Jalemkul,  
But this is a thymidine which I want to modify and build the whole structure topology.  
Is there any other forcefield that would be more suitable for this issue?

---

<div class="post-metadata">

**Author:** ![jalemkul](https://dub1.discourse-cdn.com/flex017/user_avatar/gromacs.bioexcel.eu/jalemkul/32/18_2.png) [@jalemkul](https://gromacs.bioexcel.eu/u/jalemkul)\
**Post date:** [January 19, 2022, 11:07am UTC](https://gromacs.bioexcel.eu/t/building-modified-dna-topology/3486/4 "2022-01-19T11:07:15Z")

</div>

> [@reza786](#):
>
> But this is a thymidine which I want to modify and build the whole structure topology.

I don’t understand this statement.

> [@reza786](#):
>
> Is there any other forcefield that would be more suitable for this issue?

I don’t know of any other that supports such a residue without you having to derive the parameters entirely from scratch. Why isn’t CHARMM suitable for what you need?

---

<div class="post-metadata">

**Author:** ![reza786](https://avatars.discourse-cdn.com/v4/letter/r/e8c25b/32.png) [@reza786](https://gromacs.bioexcel.eu/u/reza786)\
**Post date:** [January 21, 2022, 6:31pm UTC](https://gromacs.bioexcel.eu/t/building-modified-dna-topology/3486/5 "2022-01-21T18:31:14Z")

</div>

Thanks, dear. Because most of the articles have used Amber forcefield for RNA and DNA projects.  
you have been very helpful.