OxyGuanine in single-strand DNA

GROMACS version: 2021.4
GROMACS modification: Yes/No

Hi there. I want to make the topology of a single strand DNA but actually, it has been modified. In fact, there is a OxyGuanine in my single-strand DNA. I am wondering if any kind of software or approach exists to help me build my topology.
Here there is my sequence, all of the nucleotides are deoxy except the marked G.
TGACTAATGCCATGTTATGGGCATT